Entry Detail



General Information

Database ID:TRD06545
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tsrna-26278
tsRNA Type:i-tRF
Amino acid and Anticodon:SerGCT
Sequence:GAAAGCTCACAAGAACTGCTAACTCATGCCCCCATG
Related Target:N/A
Predicted Target:MFGE8//ZBTB37//ZDHHC22//FAM126B//SPI1//C11orf24//POU4F1//PCDHAC1//SETD6//PPP1R37
External Links:
MINTbase ID:tRF-36-O045DBNIB9I1KQ0
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12209        End Site(bp): 12244



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010195DOID:2913
Disease Name:Pancreatitisacute pancreatitis
Category:MeSHDisease Ontology
Type:Digestive System Diseasesdisease of anatomical entity
Define:INFLAMMATION of the PANCREAS. Pancreatitis is classified as acute unless there are computed tomographic or endoscopic retrograde cholangiopancreatographic findings of CHRONIC PANCREATITIS (International Symposium on Acute Pancreatitis, Atlanta, 1992). The two most common forms of acute pancreatitis are ALCOHOLIC PANCREATITIS and gallstone pancreatitis.A pancreatitis that is characterized by inflammation of the pancreas over a short period of time and has symptoms of severe abdominal pain, nausea, vomiting, diarrhea, fever, and shock.
Alias:Acute Edematous PancreatitisAcute Pancreatitis//Pancreatic Parenchyma with Edema//Pancreatic Parenchymal Edema//Pancreatitis, Acute//Pancreatitis, Acute Edematous//Peripancreatic Fat NecrosisN/A



Disease Association Statistics

Total Associated tsRNA Number:114
More Information
Network:
(Display the first 15 nodes)