tsRNADisease

Entry Detail

General Information

Database ID:	TRD06054
Confidence:	Prediction
Confidence Score:	0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

tiRNA-Val-CAC-003

tsRNA Type:

5'-tiRNA

Amino acid and Anticodon:

ValCAC

Sequence:

GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTC

Related Target:

N/A

Predicted Target:

ZBED2//CTNND2//SLC12A5//CDYL2//KIAA1549//STK36//CELA2A//ACAP1//CDC25C//HK2

External Links:

MINTbase ID:	tRF-34-79MP9P9NH57S15
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	46 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D000784	DOID:0080685
Disease Name:	Aortic dissection	aortic dissection
Category:	MeSH	Disease Ontology
Type:	Cardiovascular Diseases	disease of anatomical entity
Define:	A tear in the inner layer of the AORTA leading to interstitial HEMORRHAGE, and splitting (dissecting) of the aortic TUNICA MEDIA layer. It typically begins with a tear in the TUNICA INTIMA layer.	An aortic disease that is characterized by tearing of the intimal layer of the aorta resulting in separation of the layers of the aortic wall.
Alias:	Aneurysm, Dissecting//Aortic Dissecting Aneurysm//Dissecting Aneurysm//Dissecting Aneurysm Aorta	N/A

Disease Association Statistics

Total Associated tsRNA Number:	23 More Information
Network: (Display the first 15 nodes)