Entry Detail



General Information

Database ID:TRD06010
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tiRNA-Val-CAC-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATCACGTTCGCCTC
Related Target:N/A
Predicted Target:ZBED2//ERAP1//PTPN14//OBSCN//NPTXR//CLASRP//NR1H3//AGRN//HK2//CDC25C
External Links:
MINTbase ID:tRF-34-Q99P9P9NH57S15
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248088        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:43
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D005909DOID:3068
Disease Name:Glioblastomaglioblastoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of anatomical entity//disease of cellular proliferation
Define:A malignant form of astrocytoma histologically characterized by pleomorphism of cells, nuclear atypia, microhemorrhage, and necrosis. They may arise in any region of the central nervous system, with a predilection for the cerebral hemispheres, basal ganglia, and commissural pathways. Clinical presentation most frequently occurs in the fifth or sixth decade of life with focal neurologic signs or seizures.A malignant astrocytoma characterized by the presence of small areas of necrotizing tissue that is surrounded by anaplastic cells as well as the presence of hyperplastic blood vessels, and that has_material_basis_in abnormally proliferating cells derives_from multiple cell types including astrocytes and oligondroctyes.
Alias:Astrocytoma, Grade IV//Giant Cell Glioblastoma//Glioblastoma Multiformeadult glioblastoma multiforme//GBM//glioblastoma multiforme//grade IV adult Astrocytic tumor//primary glioblastoma multiforme//spongioblastoma multiforme



Disease Association Statistics

Total Associated tsRNA Number:32
More Information
Network:
(Display the first 15 nodes)