Entry Detail



General Information

Database ID:TRD00248
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tiRNA-1:34-Lys-CTT-3
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:LysCTT
Sequence:GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACCC
Related Target:N/A
Predicted Target:NFKBID//EBI3//RPS6KA2//JPH1//WDR54//MOB2//GULP1//SEC61A1//PES1//PLXNA1
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Lys-CTT-3-1
Anticodon:LysCTT
tRNA_number:trna32
Chromosome:16
Strand:-
Coordinate:Start Site(bp): 3207445        End Site(bp): 3207478



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D005909DOID:3068
Disease Name:Glioblastomaglioblastoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of anatomical entity//disease of cellular proliferation
Define:A malignant form of astrocytoma histologically characterized by pleomorphism of cells, nuclear atypia, microhemorrhage, and necrosis. They may arise in any region of the central nervous system, with a predilection for the cerebral hemispheres, basal ganglia, and commissural pathways. Clinical presentation most frequently occurs in the fifth or sixth decade of life with focal neurologic signs or seizures.A malignant astrocytoma characterized by the presence of small areas of necrotizing tissue that is surrounded by anaplastic cells as well as the presence of hyperplastic blood vessels, and that has_material_basis_in abnormally proliferating cells derives_from multiple cell types including astrocytes and oligondroctyes.
Alias:Astrocytoma, Grade IV//Giant Cell Glioblastoma//Glioblastoma Multiformeadult glioblastoma multiforme//GBM//glioblastoma multiforme//grade IV adult Astrocytic tumor//primary glioblastoma multiforme//spongioblastoma multiforme



Disease Association Statistics

Total Associated tsRNA Number:32
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:36526122
Disease Name:Glioblastoma
Tissue:Glioblastoma
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing
Description:A total of 9 tsRNAs were selected as candidate tsRNAs according to the tsRNA expression level, among which 6 tsRNAs were highly expressed in GBMs and 7 tsRNAs were low expressed in GBMs.
Comparision:Subtype1 VS Subtype2
Mechanism:N/A