tsRNADisease

Entry Detail

General Information

Database ID:	TRD09739
Confidence:	Prediction
Confidence Score:	0.00 (L1-norm-Graph) & 0.00 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

tRFs2

tsRNA Type:

N/A

Amino acid and Anticodon:

GluTTC

Sequence:

TCCCATATGGTCTAGCGGTTAGGATTCCTGGTTT

Related Target:

N/A

Predicted Target:

CYB561A3//SGMS2//MOB3C//PPP1R26//CLEC18A//CLEC18C//CLEC18B//COL4A3//CCDC24//PAQR4

External Links:

MINTbase ID:	tRF-34-86V8WPMN1E8Y2Q
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	12 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D000073605	DOID:11103
Disease Name:	Spotted Fever Group Rickettsiosis	rickettsialpox
Category:	MeSH	Disease Ontology
Type:	Infections	disease by infectious agent
Define:	A group of arthropod-borne diseases caused by spotted fever bio-group members of RICKETTSIA. They are characterized by fever, headache, and petechial (spotted) rash.	A spotted fever that has_material_basis_in Rickettsia akari, which is transmitted_by house mouse mite (Liponyssoides sanguineus) found on mice and other rodents. The infection has_symptom fever, has_symptom chills, has_symptom headache, has_symptom myalgia, and has_symptom papulovesicular rash.
Alias:	African Tick-Bite Fever//Far Eastern Spotted Fever//Flinders Island Spotted Fever//Japanese Spotted Fever//North Asian Tick Typhus//Queensland Tick Typhus/Rickettsia aeschlimannii Infection//Rickettsia africae Infection//Rickettsia akari Infection Rickettsia australis Infection//Rickettsia slovaca Infection//Rickettsialpox//Spotted Fever Group Rickettsioses//Spotted Fevers//TIBOLA//Tick-Borne Lymphadenopathy	Rickettsia akari spotted fever //Vesicular rickettsiosis

Disease Association Statistics

Total Associated tsRNA Number:	91 More Information
Network: (Display the first 15 nodes)