Entry Detail



General Information

Database ID:TRD09664
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRFs3
tsRNA Type:N/A
Amino acid and Anticodon:GluCTC
Sequence:TCCATGGTGGTCTAGTGGTTAGGATTCGGC
Related Target:N/A
Predicted Target:TFCP2L1//NPY4R//NPY4R2//REC8//CCSER2//NFKBIL1//SLC7A4//PCNT//CXorf40B//SGSH
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006333N/A
Disease Name:Heart FailureN/A
Category:MeSHDisease Ontology
Type:Cardiovascular DiseasesN/A
Define:A heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (VENTRICULAR DYSFUNCTION), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as MYOCARDIAL INFARCTION.N/A
Alias:Cardiac Failure//Congestive Heart Failure//Heart Decompensation//Heart Failure, Congestive//Heart Failure, Left-Sided//Heart Failure, Right-Sided//Left-Sided Heart Failure//Myocardial Failure//Right-Sided Heart FailureN/A



Disease Association Statistics

Total Associated tsRNA Number:81
More Information
Network:
(Display the first 15 nodes)