Entry Detail



General Information

Database ID:TRD09661
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRFs3
tsRNA Type:N/A
Amino acid and Anticodon:GluCTC
Sequence:TCCATGGTGGTCTAGTGGTTAGGATTCGGC
Related Target:N/A
Predicted Target:TFCP2L1//NPY4R//NPY4R2//REC8//CCSER2//NFKBIL1//SLC7A4//PCNT//CXorf40B//SGSH
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006332N/A
Disease Name:CardiomegalyN/A
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and SymptomsN/A
Define:Enlargement of the HEART, usually indicated by a cardiothoracic ratio above 0.50. Heart enlargement may involve the right, the left, or both HEART VENTRICLES or HEART ATRIA. Cardiomegaly is a nonspecific symptom seen in patients with chronic systolic heart failure (HEART FAILURE) or several forms of CARDIOMYOPATHIES.N/A
Alias:Cardiac Hypertrophy//Enlarged Heart//Heart Enlargement//Heart HypertrophyN/A



Disease Association Statistics

Total Associated tsRNA Number:68
More Information
Network:
(Display the first 15 nodes)