Entry Detail



General Information

Database ID:TRD09381
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:5P_tRNA-Asn-GTT-2-6
tsRNA Type:N/A
Amino acid and Anticodon:AsnGTT
Sequence:GAGAAGCCGGATCCTGTGGT
Related Target:N/A
Predicted Target:INTS1//SCUBE3//PLEC//GTF3C3//TLCD3B//RPL13//BTBD8//ANKEF1//ABCC11//UNC93B1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D055371N/A
Disease Name:Acute Lung InjuryN/A
Category:MeSHDisease Ontology
Type:Respiratory Tract DiseasesN/A
Define:A condition of lung damage that is characterized by bilateral pulmonary infiltrates (PULMONARY EDEMA) rich in NEUTROPHILS, and in the absence of clinical HEART FAILURE. This can represent a spectrum of pulmonary lesions, endothelial and epithelial, due to numerous factors (physical, chemical, or biological).N/A
Alias:Lung Injury, AcuteN/A



Disease Association Statistics

Total Associated tsRNA Number:109
More Information
Network:
(Display the first 15 nodes)