Entry Detail


General Information

Database ID:TRD09176
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Val-CAC-005
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATC
Related Target:N/A
Predicted Target:SLC16A7//MRPL42//KCMF1//MDM4//RGS8//KCNK5//EARS2//TCP10//FNTB//CHURC1-FNTB
External Links:
MINTbase ID:tRF-23-Q99P9P9NDD
tRFdb ID:tRFdb-5009b

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248099        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009101DOID:9538
Disease Name:Multiple Myelomamultiple myeloma
Category:MeSHDisease Ontology
Type:Neoplasms//Cardiovascular Diseases//Hemic and Lymphatic Diseases//Immune System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A malignancy of mature PLASMA CELLS engaging in monoclonal immunoglobulin production. It is characterized by hyperglobulinemia, excess Bence-Jones proteins (free monoclonal IMMUNOGLOBULIN LIGHT CHAINS) in the urine, skeletal destruction, bone pain, and fractures. Other features include ANEMIA; HYPERCALCEMIA; and RENAL INSUFFICIENCY.A myeloid neoplasm that is located_in the plasma cells in bone marrow.
Alias:Kahler Disease//Myeloma, Multiple//Myeloma, Plasma-Cell//Myeloma-Multiple//Myelomatosis//Plasma Cell Myelomamyeloma



Disease Association Statistics

Total Associated tsRNA Number:17
More Information
Network:
(Display the first 15 nodes)