Entry Detail



General Information

Database ID:TRD09174
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Val-CAC-005
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATC
Related Target:N/A
Predicted Target:SLC16A7//MRPL42//KCMF1//MDM4//RGS8//KCNK5//EARS2//TCP10//FNTB//CHURC1-FNTB
External Links:
MINTbase ID:tRF-23-Q99P9P9NDD
tRFdb ID:tRFdb-5009b

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248099        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008180DOID:9074
Disease Name:Lupus Erythematosus, Systemicsystemic lupus erythematosus
Category:MeSHDisease Ontology
Type:Skin and Connective Tissue Diseases//Immune System Diseasesdisease of anatomical entity
Define:A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys, and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow.A lupus erythematosus that is an inflammation of connective tissue marked by skin rashes, joint pain and swelling, inflammation of the kidneys and inflammation of the tissue surrounding the heart.
Alias:Libman-Sacks Disease//Lupus Erythematosus Disseminatus//Systemic Lupus Erythematosusdisseminated lupus erythematosus//Lupus Erythematosus, systemic//SLE - Lupus Erythematosus, systemic



Disease Association Statistics

Total Associated tsRNA Number:111
More Information
Network:
(Display the first 15 nodes)