Entry Detail



General Information

Database ID:TRD09170
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Val-CAC-005
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATC
Related Target:N/A
Predicted Target:SLC16A7//MRPL42//KCMF1//MDM4//RGS8//KCNK5//EARS2//TCP10//FNTB//CHURC1-FNTB
External Links:
MINTbase ID:tRF-23-Q99P9P9NDD
tRFdb ID:tRFdb-5009b

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248099        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003876DOID:3310
Disease Name:Dermatitis, Atopicatopic dermatitis
Category:MeSHDisease Ontology
Type:Congenital, Hereditary, and Neonatal Diseases and Abnormalities//Skin and Connective Tissue Diseases//Immune System Diseasesdisease of anatomical entity//integumentary system disease
Define:A chronic inflammatory genetically determined disease of the skin marked by increased ability to form reagin (IgE), with increased susceptibility to allergic rhinitis and asthma, and hereditary disposition to a lowered threshold for pruritus. It is manifested by lichenification, excoriation, and crusting, mainly on the flexural surfaces of the elbow and knee. In infants it is known as infantile eczema.An allergic contact dermatitis that is a chronically relapsing inflammatory allergic response located_in the skin that causes itching and flaking.
Alias:Eczema, Atopic//Eczema, Infantile//Neurodermatitis, Atopic//Neurodermatitis, Disseminatedallergic dermatitis//atopic eczema//Atopic neurodermatitis//Besnier's prurigo



Disease Association Statistics

Total Associated tsRNA Number:67
More Information
Network:
(Display the first 15 nodes)