Entry Detail



General Information

Database ID:TRD09168
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Val-CAC-005
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATC
Related Target:N/A
Predicted Target:SLC16A7//MRPL42//KCMF1//MDM4//RGS8//KCNK5//EARS2//TCP10//FNTB//CHURC1-FNTB
External Links:
MINTbase ID:tRF-23-Q99P9P9NDD
tRFdb ID:tRFdb-5009b

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248099        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006528DOID:684
Disease Name:Carcinoma, Hepatocellularhepatocellular carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.A liver carcinoma that has_material_basis_in undifferentiated hepatocytes and located_in the liver.
Alias:Hepatocellular Carcinoma//Hepatoma//Liver Cancer, Adult//Liver Cell Carcinoma//Liver Cell Carcinoma, AdultHepatoma



Disease Association Statistics

Total Associated tsRNA Number:61
More Information
Network:
(Display the first 15 nodes)