Entry Detail



General Information

Database ID:TRD09158
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-23-Q99P9P9NDD
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATC
Related Target:N/A
Predicted Target:SLC16A7//MRPL42//KCMF1//MDM4//RGS8//KCNK5//EARS2//TCP10//FNTB//CHURC1-FNTB
External Links:
MINTbase ID:tRF-23-Q99P9P9NDD
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248099        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010190DOID:1793
Disease Name:Pancreatic Neoplasmspancreatic cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).An endocrine gland cancer located_in the pancreas.
Alias:Cancer of Pancreas//Cancer of the Pancreas//Neoplasms, Pancreatic//Pancreas Cancer//Pancreas Neoplasms//Pancreatic CancerCa body of pancreas//Ca head of pancreas//Ca tail of pancreas//malignant neoplasm of body of pancreas//malignant neoplasm of head of pancreas//malignant neoplasm of tail of pancreas pancreas neoplasm [EXACT] pancreatic neoplasm [EXACT] pancreatic tumor [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:112
More Information
Network:
(Display the first 15 nodes)