Entry Detail



General Information

Database ID:TRD09127
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-1:28-Val-CAC-2
tsRNA Type:tRF-5
Amino acid and Anticodon:ValCAC
Sequence:GCTTCTGTAGTGTAGTGGTTATCACGTT
Related Target:N/A
Predicted Target:SREBF2//ZBED2//FNTB//CHURC1-FNTB//CASZ1//SCIN//STARD6//THOP1//PTPN14//TUBB
External Links:
MINTbase ID:tRF-28-Q99P9P9NH50E
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Val-CAC-2-1
Anticodon:ValCAC
tRNA_number:trna152
Chromosome:6
Strand:-
Coordinate:Start Site(bp): 27248094        End Site(bp): 27248121



tsRNA Association Statistics

Total Associated Disease Number:13
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002292DOID:4467
Disease Name:Carcinoma, Renal Cellclear cell renal cell carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A heterogeneous group of sporadic or hereditary carcinoma derived from cells of the KIDNEYS. There are several subtypes including the clear cells, the papillary, the chromophobe, the collecting duct, the spindle cells (sarcomatoid), or mixed cell-type carcinoma.A renal cell carcinoma that has_material_basis_in cells that appear very pale or clear when examined under microscope.
Alias:Adenocarcinoma Of Kidney//Adenocarcinoma, Renal//Adenocarcinoma, Renal Cell//Carcinoma, Hypernephroid//Chromophil Renal Cell Carcinoma//Chromophobe Renal Cell Carcinoma//Clear Cell Renal Carcinoma//Clear Cell Renal Cell Carcinoma//Collecting Duct Carcinoma//Collecting Duct Carcinoma (Kidney)//Collecting Duct Carcinoma of the Kidney//Grawitz Tumor//Hypernephroma//Nephroid Carcinoma//Papillary Renal Cell Carcinoma//Renal Carcinoma//Renal Cell Cancer//Renal Cell Carcinoma//Renal Cell Carcinoma, Papillary//Renal Collecting Duct Carcinoma//Sarcomatoid Renal Cell CarcinomaClear cell carcinoma of kidney//clear cell kidney carcinoma//Clear-cell metastatic renal cell carcinoma//Clear-cell metastatic renal cell carcinoma//conventional (Clear cell) renal cell carcinoma conventional renal cell carcinoma [EXACT] renal clear cell carcinoma [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:17
More Information
Network:
(Display the first 15 nodes)