Entry Detail



General Information

Database ID:TRD09010
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-28-OB1690PQR304
tsRNA Type:tRF-5
Amino acid and Anticodon:SerTGA
Sequence:GAAAAAGTCATGGAGGCCATGGGGTTGG
Related Target:N/A
Predicted Target:STRN4//PGLYRP2//NCOR2//SSTR1//OMP//CCHCR1//ERGIC1//ANKRD54//AGBL5//ZNF592
External Links:
MINTbase ID:tRF-28-OB1690PQR304
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerTGA
tRNA_number:trnaMT
Chromosome:MT
Strand:-
Coordinate:Start Site(bp): 7487        End Site(bp): 7514

[2] gtRNAdb_ID:-
Anticodon:SerTGA
tRNA_number:trnalookalike6
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 568038        End Site(bp): 568065



tsRNA Association Statistics

Total Associated Disease Number:15
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077195DOID:5520
Disease Name:Squamous Cell Carcinoma of Head and Neckhead and neck squamous cell carcinom
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation
Define:The most common type of head and neck carcinoma that originates from cells on the surface of the NASAL CAVITY; MOUTH; PARANASAL SINUSES, SALIVARY GLANDS, and LARYNX. Mutations in TNFRSF10B, PTEN, and ING1 genes are associated with this cancer.A head and neck carcinoma that has_material_basis_in squamous cells that line the moist, mucosal surfaces inside the head and neck.
Alias:Carcinoma, Squamous Cell of Head and Neck//HNSCC//Head And Neck Squamous Cell Carcinomas//Head and Neck Squamous Cell Carcinoma//Hypopharyngeal Squamous Cell Carcinoma//Laryngeal Squamous Cell Carcinoma//Oral Cavity Squamous Cell Carcinoma//Oral Squamous Cell Carcinoma//Oral Squamous Cell Carcinomas//Oral Tongue Squamous Cell Carcinoma//Oropharyngeal Squamous Cell Carcinoma//Squamous Cell Carcinoma of Larynx//Squamous Cell Carcinoma of the Head and Neck//Squamous Cell Carcinoma of the Larynx//Squamous Cell Carcinoma of the Mouth//Squamous Cell Carcinoma of the Nasal Cavity//Squamous Cell Carcinoma, Head And Neckcarcinoma of the head and neck//squamous cell carcinoma of the head and neck//squamous cell carcinomas of head and neck



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)