Entry Detail



General Information

Database ID:TRD08991
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-1:22-chrM.Ser-GCT
tsRNA Type:tRF-5
Amino acid and Anticodon:SerGCT
Sequence:GAGAAAGCTCACAAGAACTGCT
Related Target:N/A
Predicted Target:PTPRZ1//C4orf33//GTPBP10//SLC24A4//SCGN//ZNF540//TBC1D19//DTX4//SYNPO2//ARIH1
External Links:
MINTbase ID:tRF-22-5BF900BY3
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12207        End Site(bp): 12228



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020521N/A
Disease Name:StrokeN/A
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Cardiovascular DiseasesN/A
Define:A group of pathological conditions characterized by sudden, non-convulsive loss of neurological function due to BRAIN ISCHEMIA or INTRACRANIAL HEMORRHAGES. Stroke is classified by the type of tissue NECROSIS, such as the anatomic location, vasculature involved, etiology, age of the affected individual, and hemorrhagic vs. non-hemorrhagic nature. (From Adams et al., Principles of Neurology, 6th ed, pp777-810)N/A
Alias:Apoplexy//CVA (Cerebrovascular Accident)//Cerebral Stroke//Cerebrovascular Accident//Cerebrovascular Accident, Acute//Cerebrovascular Apoplexy//Cerebrovascular Stroke//Stroke, Acute//Vascular Accident, BrainN/A



Disease Association Statistics

Total Associated tsRNA Number:46
More Information
Network:
(Display the first 15 nodes)