Entry Detail


General Information

Database ID:TRD08990
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.00 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-1:22-chrM.Ser-GCT
tsRNA Type:tRF-5
Amino acid and Anticodon:SerGCT
Sequence:GAGAAAGCTCACAAGAACTGCT
Related Target:N/A
Predicted Target:PTPRZ1//C4orf33//GTPBP10//SLC24A4//SCGN//ZNF540//TBC1D19//DTX4//SYNPO2//ARIH1
External Links:
MINTbase ID:tRF-22-5BF900BY3
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12207        End Site(bp): 12228



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D028361N/A
Disease Name:Mitochondrial DiseasesN/A
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic DiseasesN/A
Define:Diseases caused by abnormal function of the MITOCHONDRIA. They may be caused by mutations, acquired or inherited, in mitochondrial DNA or in nuclear genes that code for mitochondrial components. They may also be the result of acquired mitochondria dysfunction due to adverse effects of drugs, infections, or other environmental causes.N/A
Alias:Electron Transport Chain Deficiencies, Mitochondrial//Mitochondrial Disorders//Mitochondrial Electron Transport Chain Deficiencies//Mitochondrial Respiratory Chain Deficiencies//Oxidative Phosphorylation Deficiencies//Respiratory Chain Deficiencies, MitochondrialN/A



Disease Association Statistics

Total Associated tsRNA Number:69
More Information
Network:
(Display the first 15 nodes)