Entry Detail



General Information

Database ID:TRD08988
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.01 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-1:22-chrM.Ser-GCT
tsRNA Type:tRF-5
Amino acid and Anticodon:SerGCT
Sequence:GAGAAAGCTCACAAGAACTGCT
Related Target:N/A
Predicted Target:PTPRZ1//C4orf33//GTPBP10//SLC24A4//SCGN//ZNF540//TBC1D19//DTX4//SYNPO2//ARIH1
External Links:
MINTbase ID:tRF-22-5BF900BY3
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12207        End Site(bp): 12228



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D049970DOID:0081120
Disease Name:Graves OphthalmopathyGraves ophthalmopathy
Category:MeSHDisease Ontology
Type:Eye Diseases//Congenital, Hereditary, and Neonatal Diseases and Abnormalities//Endocrine System Diseases//Immune System Diseasesdisease of anatomical entity
Define:An autoimmune disorder of the EYE, occurring in patients with Graves disease. Subtypes include congestive (inflammation of the orbital connective tissue), myopathic (swelling and dysfunction of the extraocular muscles), and mixed congestive-myopathic ophthalmopathy.An autoimmune disease of eyes, ear, nose and throat that is characterized by upper eyelid retraction, lid lag, swelling, redness, conjunctivitis, and bulging eyes.
Alias:Congestive Ophthalmopathy//Dysthyroid Ophthalmopathy//Edematous Ophthalmopathy//Graves Eye Disease//Graves Orbitopathy//Myopathic Ophthalmopathy//Ophthalmopathies, Thyroid-Associated//Ophthalmopathy, Infiltrative//Ophthalmopathy, Thyroid-Associated//Thyroid Eye Disease//Thyroid-Associated Ophthalmopathies//Thyroid-Associated OphthalmopathyGraves orbitopathy//Thyroid associated ophthalmopathy//thyroid eye disease



Disease Association Statistics

Total Associated tsRNA Number:31
More Information
Network:
(Display the first 15 nodes)