Entry Detail



General Information

Database ID:TRD08987
Confidence:Prediction
Confidence Score:0.03 (L1-norm-Graph) & 0.01 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-1:22-chrM.Ser-GCT
tsRNA Type:tRF-5
Amino acid and Anticodon:SerGCT
Sequence:GAGAAAGCTCACAAGAACTGCT
Related Target:N/A
Predicted Target:PTPRZ1//C4orf33//GTPBP10//SLC24A4//SCGN//ZNF540//TBC1D19//DTX4//SYNPO2//ARIH1
External Links:
MINTbase ID:tRF-22-5BF900BY3
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12207        End Site(bp): 12228



tsRNA Association Statistics

Total Associated Disease Number:14
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D005910DOID:0060108
Disease Name:Gliomabrain glioma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation//disease of anatomical entity
Define:Benign and malignant central nervous system neoplasms derived from glial cells (i.e., astrocytes, oligodendrocytes, and ependymocytes). Astrocytes may give rise to astrocytomas (ASTROCYTOMA) or glioblastoma multiforme (see GLIOBLASTOMA). Oligodendrocytes give rise to oligodendrogliomas (OLIGODENDROGLIOMA) and ependymocytes may undergo transformation to become EPENDYMOMA; CHOROID PLEXUS NEOPLASMS; or colloid cysts of the third ventricle. (From Escourolle et al., Manual of Basic Neuropathology, 2nd ed, p21)A brain cancer that has_material_basis_in glial cells.
Alias:Glial Cell Tumors//Malignant Glioma//Mixed Gliomalower grade glioma



Disease Association Statistics

Total Associated tsRNA Number:29
More Information
Network:
(Display the first 15 nodes)