Entry Detail



General Information

Database ID:TRD08552
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-20-6S7P4PWJ
tsRNA Type:tRF-5
Amino acid and Anticodon:IleAAT
Sequence:GGCCGGTTAGCTCAGTCGGC
Related Target:N/A
Predicted Target:GRWD1//PODNL1//PREX1//SRSF8//TNN//DTD1//KIFC2//CILP//CELA3B//RPL15
External Links:
MINTbase ID:tRF-20-6S7P4PWJ
tRFdb ID:tRNA-Ile-AAT-8-1

[1] gtRNAdb_ID:tRNA-Ile-AAT-8-1
Anticodon:IleAAT
tRNA_number:trna57
Chromosome:6
Strand:+
Coordinate:Start Site(bp): 27636362        End Site(bp): 27636381



tsRNA Association Statistics

Total Associated Disease Number:15
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010051DOID:2394
Disease Name:Ovarian Neoplasmsovarian cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS. A female reproductive organ cancer that is located_in the ovary.
Alias:Cancer of Ovary//Cancer of the Ovary//Neoplasms, Ovarian//Ovarian Cancer//Ovary Cancer//Ovary Neoplasmsmalignant Ovarian tumor//malignant tumour of ovary//ovarian neoplasm//ovary neoplasm//primary ovarian cancer//tumor of the Ovary



Disease Association Statistics

Total Associated tsRNA Number:74
More Information
Network:
(Display the first 15 nodes)