Entry Detail



General Information

Database ID:TRD08547
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-20-6S7P4PWJ
tsRNA Type:tRF-5
Amino acid and Anticodon:IleAAT
Sequence:GGCCGGTTAGCTCAGTCGGC
Related Target:N/A
Predicted Target:GRWD1//PODNL1//PREX1//SRSF8//TNN//DTD1//KIFC2//CILP//CELA3B//RPL15
External Links:
MINTbase ID:tRF-20-6S7P4PWJ
tRFdb ID:tRNA-Ile-AAT-8-1

[1] gtRNAdb_ID:tRNA-Ile-AAT-8-1
Anticodon:IleAAT
tRNA_number:trna57
Chromosome:6
Strand:+
Coordinate:Start Site(bp): 27636362        End Site(bp): 27636381



tsRNA Association Statistics

Total Associated Disease Number:15
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006528DOID:684
Disease Name:Carcinoma, Hepatocellularhepatocellular carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.A liver carcinoma that has_material_basis_in undifferentiated hepatocytes and located_in the liver.
Alias:Hepatocellular Carcinoma//Hepatoma//Liver Cancer, Adult//Liver Cell Carcinoma//Liver Cell Carcinoma, AdultHepatoma



Disease Association Statistics

Total Associated tsRNA Number:61
More Information
Network:
(Display the first 15 nodes)