Entry Detail


General Information

Database ID:TRD08546
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-20-6S7P4PWJ
tsRNA Type:tRF-5
Amino acid and Anticodon:IleAAT
Sequence:GGCCGGTTAGCTCAGTCGGC
Related Target:N/A
Predicted Target:GRWD1//PODNL1//PREX1//SRSF8//TNN//DTD1//KIFC2//CILP//CELA3B//RPL15
External Links:
MINTbase ID:tRF-20-6S7P4PWJ
tRFdb ID:tRNA-Ile-AAT-8-1

[1] gtRNAdb_ID:tRNA-Ile-AAT-8-1
Anticodon:IleAAT
tRNA_number:trna57
Chromosome:6
Strand:+
Coordinate:Start Site(bp): 27636362        End Site(bp): 27636381



tsRNA Association Statistics

Total Associated Disease Number:15
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D018270DOID:3008
Disease Name:Carcinoma, Ductal, Breastinvasive ductal carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:An invasive (infiltrating) CARCINOMA of the mammary ductal system (MAMMARY GLANDS) in the human BREAST.A breast ductal carcinoma that is characterized by infiltration into the fibrous or fatty tissue of the breast outside of the duct where it originated.
Alias:Carcinoma, Infiltrating Duct//Carcinoma, Invasive Ductal, Breast//Carcinoma, Mammary Ductal//Invasive Ductal Carcinoma, Breast//Mammary Ductal Carcinomaductal adenocarcinoma//Infiltrating ductal carcinoma of breast//Invasive ductal carcinoma, NST



Disease Association Statistics

Total Associated tsRNA Number:26
More Information
Network:
(Display the first 15 nodes)