tsRNADisease

Entry Detail

General Information

Database ID:	TRD08545
Confidence:	Prediction
Confidence Score:	0.06 (L1-norm-Graph) & 0.08 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

tRF-20-6S7P4PWJ

tsRNA Type:

tRF-5

Amino acid and Anticodon:

IleAAT

Sequence:

GGCCGGTTAGCTCAGTCGGC

Related Target:

N/A

Predicted Target:

GRWD1//PODNL1//PREX1//SRSF8//TNN//DTD1//KIFC2//CILP//CELA3B//RPL15

External Links:

MINTbase ID:	tRF-20-6S7P4PWJ
tRFdb ID:	tRNA-Ile-AAT-8-1

tsRNA Association Statistics

Total Associated Disease Number:	15 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D001943	DOID:1612
Disease Name:	Breast Neoplasms	breast cancer
Category:	MeSH	Disease Ontology
Type:	Neoplasms//Skin and Connective Tissue Diseases	disease of anatomical entity//disease of cellular proliferation
Define:	Tumors or cancer of the human BREAST.	A thoracic cancer that originates in the mammary gland.
Alias:	Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breast	breast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer

Disease Association Statistics

Total Associated tsRNA Number:	549 More Information
Network: (Display the first 15 nodes)