Entry Detail



General Information

Database ID:TRD08435
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Gly-TCC-012
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyTCC
Sequence:GCGTTGGTGGTATAGTGGTTAGCATAGC
Related Target:N/A
Predicted Target:PHGDH//SLC6A4//LRP1//OTOG//WNK4//ZBED3//CSMD2//C3//B3GALT5//ITPR1
External Links:
MINTbase ID:tRF-28-QNR8VP9NFQ9
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Gly-TCC-1-1
Anticodon:GlyTCC
tRNA_number:trna2
Chromosome:19
Strand:+
Coordinate:Start Site(bp): 4724082        End Site(bp): 4724109



tsRNA Association Statistics

Total Associated Disease Number:5
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003924DOID:9352
Disease Name:Diabetes Mellitus, Type 2type 2 diabetes mellitus
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic Diseases//Endocrine System Diseasesdisease of metabolism//genetic disease
Define:A subclass of DIABETES MELLITUS that is not INSULIN-responsive or dependent (NIDDM). It is characterized initially by INSULIN RESISTANCE and HYPERINSULINEMIA; and eventually by GLUCOSE INTOLERANCE; HYPERGLYCEMIA; and overt diabetes. Type II diabetes mellitus is no longer considered a disease exclusively found in adults. Patients seldom develop KETOSIS but often exhibit OBESITY.A diabetes mellitus that is characterized by high blood sugar, insulin resistance, and relative lack of insulin.
Alias:Diabetes Mellitus, Adult-Onset//Diabetes Mellitus, Ketosis-Resistant//Diabetes Mellitus, Maturity-Onset//Diabetes Mellitus, Non Insulin Dependent//Diabetes Mellitus, Non-Insulin-Dependent//Diabetes Mellitus, Noninsulin Dependent//Diabetes Mellitus, Noninsulin-Dependent//Diabetes Mellitus, Slow-Onset//Diabetes Mellitus, Stable//Diabetes Mellitus, Type II//MODY//Maturity-Onset Diabetes//Maturity-Onset Diabetes Mellitus//NIDDM//Noninsulin-Dependent Diabetes Mellitus//Type 2 Diabetes//Type 2 Diabetes Mellitusinsulin resistance//NIDDM//non-insulin-dependent diabetes mellitus//type 2 diabetes//type II diabetes mellitus



Disease Association Statistics

Total Associated tsRNA Number:61
More Information
Network:
(Display the first 15 nodes)