Entry Detail



General Information

Database ID:TRD08370
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.05 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:AS-tDR-007333_n1
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyGCC
Sequence:AAGAATTCTACCACTGAACCACCAATGC
Related Target:N/A
Predicted Target:PBX2//ADAM10//ATP6AP2//MOGS//CPOX//TRIM56//KRT4//KIF3B//POLG2//BNIP1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002289DOID:3908
Disease Name:Carcinoma, Non-Small-Cell Lunglung non-small cell carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Respiratory Tract Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy.A lung carcinoma that is characterized as any type of epithelial lung cancer other than small cell lung carcinoma.
Alias:Carcinoma, Non-Small Cell Lung//Non-Small Cell Lung Cancer//Non-Small Cell Lung Carcinoma//Non-Small-Cell Lung Carcinoma//Nonsmall Cell Lung CancerNon-small cell lung cancer//non-small cell lung carcinoma//NSCLC



Disease Association Statistics

Total Associated tsRNA Number:132
More Information
Network:
(Display the first 15 nodes)