Entry Detail



General Information

Database ID:TRD08366
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:AS-tDR-007303
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyGCC
Sequence:GCATGGGTGGTTCAGTGGTAGAATTCTT
Related Target:N/A
Predicted Target:FCGR2A//SORCS1//HSD17B4//MRPS5//SP3//TNS2//DDI1//CDCP2//AL357673.1//UBN1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001749DOID:4006
Disease Name:Urinary Bladder Neoplasmsbladder urothelial carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of cellular proliferation//disease of anatomical entity
Define:Tumors or cancer of the URINARY BLADDER.A bladder carcinoma that has_material_basis_in transitional cells located_in the lining of the bladder.
Alias:Bladder Cancer//Bladder Neoplasms//Bladder Tumors//Cancer of Bladder//Cancer of the Bladder//Malignant Tumor of Urinary Bladder//Neoplasms, Bladder//Urinary Bladder Cancerbladder transitional cell carcinoma//transitional cell carcinoma of bladder//urinary bladder urothelial carcinoma//urothelial bladder carcinoma



Disease Association Statistics

Total Associated tsRNA Number:41
More Information
Network:
(Display the first 15 nodes)