Entry Detail



General Information

Database ID:TRD08355
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.05 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:5'GlyGCC
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyGCC
Sequence:AATCCTAACCACTAGACCACCAGGGA
Related Target:N/A
Predicted Target:HMCN2//REEP4//KCNJ10//FIS1//SERPINB6//SPSB2//ZHX2//CD84//CADM1//B3GALT5
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009103DOID:2377
Disease Name:Multiple Sclerosismultiple sclerosis
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Nervous System Diseases//Immune System Diseasesdisease of anatomical entity//nervous system disease
Define:An autoimmune disorder mainly affecting young adults and characterized by destruction of myelin in the central nervous system. Pathologic findings include multiple sharply demarcated areas of demyelination throughout the white matter of the central nervous system. Clinical manifestations include visual loss, extra-ocular movement disorders, paresthesias, loss of sensation, weakness, dysarthria, spasticity, ataxia, and bladder dysfunction. The usual pattern is one of recurrent attacks followed by partial recovery (see MULTIPLE SCLEROSIS, RELAPSING-REMITTING), but acute fulminating and chronic progressive forms (see MULTIPLE SCLEROSIS, CHRONIC PROGRESSIVE) also occur. (Adams et al., Principles of Neurology, 6th ed, p903)A demyelinating disease that involves damage to the fatty myelin sheaths around the axons of the brain and spinal cord resulting in demyelination and scarring.
Alias:MS (Multiple Sclerosis)//Multiple Sclerosis, Acute Fulminating//Sclerosis, DisseminatedGeneralized multiple sclerosis//insular sclerosis



Disease Association Statistics

Total Associated tsRNA Number:120
More Information
Network:
(Display the first 15 nodes)