Entry Detail



General Information

Database ID:TRD08216
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Glu-TTC-020
tsRNA Type:tRF-5
Amino acid and Anticodon:GluTTC
Sequence:TCCCATATGGTCTAGCGGTTAGGATTCCTGG
Related Target:N/A
Predicted Target:CYB561A3//PPP1R26//SGMS2//MOB3C//CCDC24//CLEC18A//CLEC18B//CLEC18C//COPS5//GNAZ
External Links:
MINTbase ID:tRF-31-86V8WPMN1E8Y0
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Glu-TTC-1-2
Anticodon:GluTTC
tRNA_number:trna5
Chromosome:13
Strand:-
Coordinate:Start Site(bp): 41634915        End Site(bp): 41634945

[2] gtRNAdb_ID:tRNA-Glu-TTC-1-1
Anticodon:GluTTC
tRNA_number:trna20
Chromosome:2
Strand:-
Coordinate:Start Site(bp): 131094742        End Site(bp): 131094772



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020529DOID:2378
Disease Name:Multiple Sclerosis, Relapsing-Remittingrelapsing-remitting multiple sclerosis
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Immune System Diseasesdisease of anatomical entity//nervous system disease
Define:The most common clinical variant of MULTIPLE SCLEROSIS, characterized by recurrent acute exacerbations of neurologic dysfunction followed by partial or complete recovery. Common clinical manifestations include loss of visual (see OPTIC NEURITIS), motor, sensory, or bladder function. Acute episodes of demyelination may occur at any site in the central nervous system, and commonly involve the optic nerves, spinal cord, brain stem, and cerebellum. (Adams et al., Principles of Neurology, 6th ed, pp903-914)A multiple sclerosis that is characterized by relapse (attacks of symptom flare-ups) followed by remission (periods of recovery). Symptoms may vary from mild to severe, and relapses and remissions may last for days or months. More than 80 percent of people who have MS begin with relapsing-remitting cycles.
Alias:Acute Relapsing Multiple Sclerosis//Multiple Sclerosis, Acute Relapsing//Relapsing-Remitting Multiple Sclerosis//Remitting-Relapsing Multiple SclerosisRelapsing-remitting MS//RRMS



Disease Association Statistics

Total Associated tsRNA Number:74
More Information
Network:
(Display the first 15 nodes)