Entry Detail



General Information

Database ID:TRD08199
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Glu-TTC-010
tsRNA Type:tRF-5
Amino acid and Anticodon:GluTTC
Sequence:TCCCACATGGTCTAGCGGTTAGGATTCCT
Related Target:N/A
Predicted Target:PPP1R26//ZNF654//COLGALT1//SGMS2//CLEC18A//CLEC18C//CLEC18B//GFER//SLC2A10//KCNF1
External Links:
MINTbase ID:tRF-29-86J8WPMN1EJ3
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Glu-TTC-2-1
Anticodon:GluTTC
tRNA_number:trna3
Chromosome:13
Strand:-
Coordinate:Start Site(bp): 45492105        End Site(bp): 45492133

[2] gtRNAdb_ID:tRNA-Glu-TTC-2-2
Anticodon:GluTTC
tRNA_number:trna11
Chromosome:15
Strand:-
Coordinate:Start Site(bp): 26327424        End Site(bp): 26327452



tsRNA Association Statistics

Total Associated Disease Number:13
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010300DOID:14330
Disease Name:Parkinson DiseaseParkinson's disease
Category:MeSHDisease Ontology
Type:Nervous System Diseasesdisease of anatomical entity
Define:A progressive, degenerative neurologic disease characterized by a TREMOR that is maximal at rest, retropulsion (i.e. a tendency to fall backwards), rigidity, stooped posture, slowness of voluntary movements, and a masklike facial expression. Pathologic features include loss of melanin containing neurons in the substantia nigra and other pigmented nuclei of the brainstem. LEWY BODIES are present in the substantia nigra and locus coeruleus but may also be found in a related condition (LEWY BODY DISEASE, DIFFUSE) characterized by dementia in combination with varying degrees of parkinsonism. (Adams et al., Principles of Neurology, 6th ed, p1059, pp1067-75)A synucleinopathy that has_material_basis_in degeneration of the central nervous system that often impairs motor skills, speech, and other functions.
Alias:Idiopathic Parkinson Disease//Idiopathic Parkinson's Disease//Lewy Body Parkinson Disease//Lewy Body Parkinson's Disease//Paralysis Agitans//Parkinson Disease, Idiopathic//Parkinson's Disease//Parkinson's Disease, Idiopathic//Parkinson's Disease, Lewy Body//Primary Parkinsonismparalysis agitans//Parkinson disease



Disease Association Statistics

Total Associated tsRNA Number:84
More Information
Network:
(Display the first 15 nodes)