Entry Detail



General Information

Database ID:TRD08193
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Glu-TTC-010
tsRNA Type:tRF-5
Amino acid and Anticodon:GluTTC
Sequence:TCCCACATGGTCTAGCGGTTAGGATTCCT
Related Target:N/A
Predicted Target:PPP1R26//ZNF654//COLGALT1//SGMS2//CLEC18A//CLEC18C//CLEC18B//GFER//SLC2A10//KCNF1
External Links:
MINTbase ID:tRF-29-86J8WPMN1EJ3
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Glu-TTC-2-1
Anticodon:GluTTC
tRNA_number:trna3
Chromosome:13
Strand:-
Coordinate:Start Site(bp): 45492105        End Site(bp): 45492133

[2] gtRNAdb_ID:tRNA-Glu-TTC-2-2
Anticodon:GluTTC
tRNA_number:trna11
Chromosome:15
Strand:-
Coordinate:Start Site(bp): 26327424        End Site(bp): 26327452



tsRNA Association Statistics

Total Associated Disease Number:13
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000690DOID:332
Disease Name:Amyotrophic Lateral Sclerosisamyotrophic lateral sclerosis
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Nutritional and Metabolic Diseasesdisease of anatomical entity
Define:A degenerative disorder affecting upper MOTOR NEURONS in the brain and lower motor neurons in the brain stem and SPINAL CORD. Disease onset is usually after the age of 50 and the process is usually fatal within 3 to 6 years. Clinical manifestations include progressive weakness, atrophy, FASCICULATION, hyperreflexia, DYSARTHRIA, dysphagia, and eventual paralysis of respiratory function. Pathologic features include the replacement of motor neurons with fibrous ASTROCYTES and atrophy of anterior SPINAL NERVE ROOTS and corticospinal tracts. (From Adams et al., Principles of Neurology, 6th ed, pp1089-94)A motor neuron disease that is characterized by muscle spasticity, rapidly progressive weakness due to muscle atrophy, difficulty in speaking, swallowing, and breathing.
Alias:ALS - Amyotrophic Lateral Sclerosis//Amyotrophic Lateral Sclerosis With Dementia//Amyotrophic Lateral Sclerosis, Guam Form//Amyotrophic Lateral Sclerosis, Parkinsonism-Dementia Complex of Guam//Amyotrophic Lateral Sclerosis-Parkinsonism-Dementia Complex 1//Charcot Disease//Dementia With Amyotrophic Lateral Sclerosis//Gehrig's Disease//Guam Disease//Guam Form of Amyotrophic Lateral Sclerosis//Lou Gehrig Disease//Lou Gehrig's Disease//Lou-Gehrigs Disease//Motor Neuron Disease, Amyotrophic Lateral SclerosisALS//Lou Gehrig's disease//motor neuron disease, bulbar



Disease Association Statistics

Total Associated tsRNA Number:57
More Information
Network:
(Display the first 15 nodes)