Entry Detail



General Information

Database ID:TRD08086
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:5'GluCTC
tsRNA Type:tRF-5
Amino acid and Anticodon:GluCTC
Sequence:AATCCTAACCACTAGACCACCAGGGA
Related Target:N/A
Predicted Target:HMCN2//REEP4//KCNJ10//FIS1//SERPINB6//SPSB2//ZHX2//CD84//CADM1//B3GALT5
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002532DOID:10941
Disease Name:Intracranial Aneurysmintracranial aneurysm
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Cardiovascular Diseasesdisease of anatomical entity//nervous system disease
Define:Abnormal outpouching in the wall of intracranial blood vessels. Most common are the saccular (berry) aneurysms located at branch points in CIRCLE OF WILLIS at the base of the brain. Vessel rupture results in SUBARACHNOID HEMORRHAGE or INTRACRANIAL HEMORRHAGES. Giant aneurysms (>2.5 cm in diameter) may compress adjacent structures, including the OCULOMOTOR NERVE. (From Adams et al., Principles of Neurology, 6th ed, p841)N/A
Alias:Aneurysm, Anterior Cerebral Artery//Aneurysm, Anterior Communicating Artery//Aneurysm, Basilar Artery//Aneurysm, Cerebral//Aneurysm, Intracranial//Aneurysm, Middle Cerebral Artery//Aneurysm, Posterior Cerebral Artery//Aneurysm, Posterior Communicating Artery//Anterior Cerebral Artery Aneurysm///Anterior Communicating Artery Aneurysm//Basilar Artery Aneurysm//Berry Aneurysm//Brain Aneurysm//Cerebral Aneurysm//Giant Intracranial Aneurysm//Middle Cerebral//Artery Aneurysm//Mycotic Aneurysm, Intracranial//Posterior Cerebral Artery Aneurysm//Posterior Communicating Artery Aneurysmbrain aneurysm



Disease Association Statistics

Total Associated tsRNA Number:66
More Information
Network:
(Display the first 15 nodes)