Entry Detail



General Information

Database ID:TRD08084
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:5'GluCTC
tsRNA Type:tRF-5
Amino acid and Anticodon:GluCTC
Sequence:AATCCTAACCACTAGACCACCAGGGA
Related Target:N/A
Predicted Target:HMCN2//REEP4//KCNJ10//FIS1//SERPINB6//SPSB2//ZHX2//CD84//CADM1//B3GALT5
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020212DOID:3407
Disease Name:Carotid Artery Injuriescarotid artery disease
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Cardiovascular Diseases//Wounds and Injuriesdisease of anatomical entity
Define:Damages to the CAROTID ARTERIES caused either by blunt force or penetrating trauma, such as CRANIOCEREBRAL TRAUMA; THORACIC INJURIES; and NECK INJURIES. Damaged carotid arteries can lead to CAROTID ARTERY THROMBOSIS; CAROTID-CAVERNOUS SINUS FISTULA; pseudoaneurysm formation; and INTERNAL CAROTID ARTERY DISSECTION. (From Am J Forensic Med Pathol 1997, 18:251; J Trauma 1994, 37:473)N/A
Alias:Carotid Arteriopathies, Traumatic//Carotid False Aneurysm//Carotid Pseudoaneurysm//False Aneurysm, Carotid//Injuries, Carotid Artery//Trauma, Carotid Arterydisorder of carotid artery



Disease Association Statistics

Total Associated tsRNA Number:47
More Information
Network:
(Display the first 15 nodes)