Entry Detail


General Information

Database ID:TRD08010
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.04 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Arg-TCT-008
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GGCTCCGTGGCGCAATGGATAGCGCATTGG
Related Target:N/A
Predicted Target:HES7//TULP4//OR10J1//SLC25A29//DENND2A//DBNDD1//HIP1R//ADAMTS5//TRPT1//SLC25A18
External Links:
MINTbase ID:tRF-21-B54ZUPX1B
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-TCT-1-1
Anticodon:ArgTCT
tRNA_number:trna9
Chromosome:1
Strand:+
Coordinate:Start Site(bp): 94313129        End Site(bp): 94313158



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D016889DOID:0050939
Disease Name:Endometrial Neoplasmsuterine corpus endometrial carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of cellular proliferation//disease of anatomical entity
Define:Tumors or cancer of ENDOMETRIUM, the mucous lining of the UTERUS. These neoplasms can be benign or malignant. Their classification and grading are based on the various cell types and the percent of undifferentiated cells.A uterine corpus cancer that is derives_from the inner lining of the uterus.
Alias:Cancer of Endometrium//Cancer of the Endometrium//Carcinoma of Endometrium//Endometrial Cancer//Endometrial Carcinoma//Endometrium Cancer//Neoplasms, EndometrialN/A



Disease Association Statistics

Total Associated tsRNA Number:227
More Information
Network:
(Display the first 15 nodes)