Entry Detail



General Information

Database ID:TRD07994
Confidence:Prediction
Confidence Score:0.05 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008545 DOID:1909
Disease Name:Melanomamelanoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation
Define:A malignant neoplasm derived from cells that are capable of forming melanin, which may occur in the skin of any part of the body, in the eye, or, rarely, in the mucous membranes of the genitalia, anus, oral cavity, or other sites. It occurs mostly in adults and may originate de novo or from a pigmented nevus or malignant lentigo. Melanomas frequently metastasize widely, and the regional lymph nodes, liver, lungs, and brain are likely to be involved. The incidence of malignant skin melanomas is rising rapidly in all parts of the world. (Stedman, 25th ed; from Rook et al., Textbook of Dermatology, 4th ed, p2445)A cell type cancer that has_material_basis_in abnormally proliferating cells derives_from melanocytes which are found in skin, the bowel and the eye.
Alias:Malignant Melanomamalignant melanoma//Naevocarcinoma



Disease Association Statistics

Total Associated tsRNA Number:17
More Information
Network:
(Display the first 15 nodes)