Entry Detail



General Information

Database ID:TRD07936
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.05 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF5-AlaCGC_n1
tsRNA Type:tRF-5
Amino acid and Anticodon:AlaCGC
Sequence:GGGGATGTAGCTCAGTGGTAGAGCGCGCTTC
Related Target:P65
Predicted Target:ST3GAL3//SUFU//SNX14//TPM1//NSD2//CYP46A1//MAPK12//PRDM15//FGF17//FOXL2
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D005235N/A
Disease Name:Fatty Liver, AlcoholicN/A
Category:MeSHDisease Ontology
Type:Digestive System Diseases//Chemically-Induced DisordersN/A
Define:Lipid infiltration of the hepatic parenchymal cells that is due to ALCOHOL ABUSE. The fatty changes in the alcoholic fatty liver may be reversible, depending on the amounts of TRIGLYCERIDES accumulated.N/A
Alias:Alcoholic Fatty Liver//Alcoholic SteatohepatitisN/A



Disease Association Statistics

Total Associated tsRNA Number:49
More Information
Network:
(Display the first 15 nodes)