Entry Detail


General Information

Database ID:TRD07931
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Ala-CGC-006
tsRNA Type:tRF-5
Amino acid and Anticodon:AlaCGC
Sequence:GGGGATGTAGCTCAGTGGTAGAGCGCGCGCTT
Related Target:N/A
Predicted Target:GARS//TPPP//TPM1//RAB39B//FCHSD2//RNF138//NPHP4//AGPAT3//DLGAP2//SUFU
External Links:
MINTbase ID:tRF-32-R29P4P9L5HLVQ
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Ala-CGC-3-1
Anticodon:AlaCGC
tRNA_number:trna13
Chromosome:2
Strand:+
Coordinate:Start Site(bp): 157257281        End Site(bp): 157257312



tsRNA Association Statistics

Total Associated Disease Number:5
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008113DOID:3571
Disease Name:Liver Neoplasmsliver cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the LIVER.A hepatobiliary system cancer that is located_in the liver.
Alias:Cancer of Liver//Cancer of the Liver//Cancer, Hepatocellular//Hepatic Cancer//Hepatic Neoplasms//Hepatocellular Cancer//Liver Cancer//Neoplasms, Hepatic//Neoplasms, LiverCa liver - primary//hepatic cancer//hepatic neoplasm//malignant hepato-biliary neoplasm//malignant neoplasm of liver//malignant neoplasm of liver, not specified as primary or secondary malignant neoplasm of liver, primary [EXACT] malignant tumor of liver [EXACT] neoplasm of liver [EXACT] non-resectable primary hepatic malignant neoplasm [EXACT] primary liver cancer [EXACT] primary malignant neoplasm of liver [EXACT] Resectable malignant neoplasm of Liver [EXACT] resectable malignant neoplasm of the liver [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:39
More Information
Network:
(Display the first 15 nodes)