Entry Detail



General Information

Database ID:TRD07560
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Ser-GCT-035
tsRNA Type:tRF-3
Amino acid and Anticodon:SerGCT
Sequence:TAACAACATGGCTTTCTCACCA
Related Target:N/A
Predicted Target:S100A7L2//SNX25//DYNC1LI2//SGSM3//TSEN2//TENT5A//AL022238.4//PALD1//SGK1//DCDC1
External Links:
MINTbase ID:tRF-22-UF04QZ452
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerGCT
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 12247        End Site(bp): 12265+3



tsRNA Association Statistics

Total Associated Disease Number:7
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003865DOID:1470
Disease Name:Depressive Disorder, Majormajor depressive disorder
Category:MeSHDisease Ontology
Type:Mental Disordersdisease of mental health
Define:Disorder in which five (or more) of the following symptoms have been present during the same 2-week period and represent a change from previous functioning; at least one of the symptoms is either (1) depressed mood or (2) loss of interest or pleasure. Symptoms include: depressed mood most of the day, nearly every daily; markedly diminished interest or pleasure in activities most of the day, nearly every day; significant weight loss when not dieting or weight gain; Insomnia or hypersomnia nearly every day; psychomotor agitation or retardation nearly every day; fatigue or loss of energy nearly every day; feelings of worthlessness or excessive or inappropriate guilt; diminished ability to think or concentrate, or indecisiveness, nearly every day; or recurrent thoughts of death, recurrent suicidal ideation without a specific plan, or a suicide attempt. (DSM-5)A depressive disorder that is characterized by at least two weeks of loss of interest or pleasure in normally enjoyable activities or depressed mood along with additional cognitive or somatic impairments such as appetite or weight changes, sleep difficulties, psychomotor agitation or retardation, fatigue or loss of energy, diminished ability to think or concentrate, feelings of worthlessness or excessive guilt, and suicidality.
Alias:Depression, Involutional//Major Depressive Disorder//Melancholia, Involutional//Paraphrenia, Involutional//Psychosis, Involutionalclinical depression//major depression//recurrent major depression//single major depressive episode//unipolar depression



Disease Association Statistics

Total Associated tsRNA Number:93
More Information
Network:
(Display the first 15 nodes)