tsRNADisease

Entry Detail

General Information

Database ID:	TRD07546
Confidence:	Prediction
Confidence Score:	0.02 (L1-norm-Graph) & 0.04 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

3b_tRF-Pro-TGG/AGG/CGG

tsRNA Type:

tRF-3

Amino acid and Anticodon:

ProTGG;ProAGG;ProCGG

Sequence:

TCAAATCCCGGACGAGCCCCCA

Related Target:

N/A

Predicted Target:

PLPPR5//CILP2//SLC4A3//TAF5L//MXRA5//PTPRB//ZBED1//ITGB2//MLST8//ST3GAL1

External Links:

MINTbase ID:	tRF-22-8B8SOUPR2
tRFdb ID:	tRFdb-3002b

[1] gtRNAdb_ID:	tRNA-Pro-AGG-2-1
Anticodon:	ProAGG
tRNA_number:	trna65
Chromosome:	1
Strand:	-
Coordinate:	Start Site(bp): 167684725-3 End Site(bp): 167684743

[2] gtRNAdb_ID:	tRNA-Pro-AGG-2-4
Anticodon:	ProAGG
tRNA_number:	trna9
Chromosome:	11
Strand:	+
Coordinate:	Start Site(bp): 75946610 End Site(bp): 75946628+3

[3] gtRNAdb_ID:	tRNA-Pro-AGG-2-6
Anticodon:	ProAGG
tRNA_number:	trna22
Chromosome:	14
Strand:	-
Coordinate:	Start Site(bp): 21081560-3 End Site(bp): 21081578

[4] gtRNAdb_ID:	tRNA-Pro-AGG-2-5
Anticodon:	ProAGG
tRNA_number:	trna23
Chromosome:	14
Strand:	-
Coordinate:	Start Site(bp): 21077495-3 End Site(bp): 21077513

[5] gtRNAdb_ID:	tRNA-Pro-AGG-2-7
Anticodon:	ProAGG
tRNA_number:	trna29
Chromosome:	16
Strand:	-
Coordinate:	Start Site(bp): 3232635-3 End Site(bp): 3232653

[6] gtRNAdb_ID:	tRNA-Pro-AGG-2-8
Anticodon:	ProAGG
tRNA_number:	trna9
Chromosome:	16
Strand:	+
Coordinate:	Start Site(bp): 3239687 End Site(bp): 3239705+3

[7] gtRNAdb_ID:	tRNA-Pro-AGG-2-2
Anticodon:	ProAGG
tRNA_number:	trna12
Chromosome:	6
Strand:	+
Coordinate:	Start Site(bp): 26555551 End Site(bp): 26555569+3

[8] gtRNAdb_ID:	tRNA-Pro-AGG-2-3
Anticodon:	ProAGG
tRNA_number:	trna2
Chromosome:	7
Strand:	+
Coordinate:	Start Site(bp): 128423557 End Site(bp): 128423575+3

[9] gtRNAdb_ID:	tRNA-Pro-AGG-1-1
Anticodon:	ProAGG
tRNA_number:	trna11
Chromosome:	16
Strand:	+
Coordinate:	Start Site(bp): 3242042 End Site(bp): 3242060+3

[10] gtRNAdb_ID:	tRNA-Pro-CGG-2-1
Anticodon:	ProCGG
tRNA_number:	trna30
Chromosome:	6
Strand:	+
Coordinate:	Start Site(bp): 27059574 End Site(bp): 27059592+3

[11] gtRNAdb_ID:	tRNA-Pro-CGG-1-1
Anticodon:	ProCGG
tRNA_number:	trna52
Chromosome:	1
Strand:	+
Coordinate:	Start Site(bp): 167684015 End Site(bp): 167684033+3

[12] gtRNAdb_ID:	tRNA-Pro-CGG-1-2
Anticodon:	ProCGG
tRNA_number:	trna6
Chromosome:	16
Strand:	+
Coordinate:	Start Site(bp): 3222102 End Site(bp): 3222120+3

[13] gtRNAdb_ID:	tRNA-Pro-CGG-1-3
Anticodon:	ProCGG
tRNA_number:	trna37
Chromosome:	17
Strand:	-
Coordinate:	Start Site(bp): 8126151-3 End Site(bp): 8126169

[14] gtRNAdb_ID:	tRNA-Pro-TGG-3-2
Anticodon:	ProTGG
tRNA_number:	trna6
Chromosome:	14
Strand:	+
Coordinate:	Start Site(bp): 21152228 End Site(bp): 21152246+3

[15] gtRNAdb_ID:	tRNA-Pro-TGG-3-4
Anticodon:	ProTGG
tRNA_number:	trna28
Chromosome:	16
Strand:	-
Coordinate:	Start Site(bp): 3234133-3 End Site(bp): 3234151

[16] gtRNAdb_ID:	tRNA-Pro-TGG-3-3
Anticodon:	ProTGG
tRNA_number:	trna3
Chromosome:	16
Strand:	+
Coordinate:	Start Site(bp): 3208976 End Site(bp): 3208994+3

[17] gtRNAdb_ID:	tRNA-Pro-TGG-3-5
Anticodon:	ProTGG
tRNA_number:	trna8
Chromosome:	16
Strand:	+
Coordinate:	Start Site(bp): 3238147 End Site(bp): 3238165+3

[18] gtRNAdb_ID:	tRNA-Pro-TGG-3-1
Anticodon:	ProTGG
tRNA_number:	trna14
Chromosome:	5
Strand:	-
Coordinate:	Start Site(bp): 180615854-3 End Site(bp): 180615872

[19] gtRNAdb_ID:	tRNA-Pro-TGG-2-1
Anticodon:	ProTGG
tRNA_number:	trna12
Chromosome:	11
Strand:	-
Coordinate:	Start Site(bp): 75946869-3 End Site(bp): 75946887

[20] gtRNAdb_ID:	tRNA-Pro-TGG-1-1
Anticodon:	ProTGG
tRNA_number:	trna3
Chromosome:	14
Strand:	+
Coordinate:	Start Site(bp): 21101218 End Site(bp): 21101236+3

[21] gtRNAdb_ID:	tRNA-Pro-AGG-3-1
Anticodon:	ProAGG
tRNA_number:	trna4
Chromosome:	16
Strand:	+
Coordinate:	Start Site(bp): 3210462 End Site(bp): 3210480+3

tsRNA Association Statistics

Total Associated Disease Number:	2 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D008175	DOID:1324
Disease Name:	Lung Neoplasms	lung cancer
Category:	MeSH	Disease Ontology
Type:	Neoplasms//Respiratory Tract Diseases	disease of anatomical entity//disease of cellular proliferation
Define:	Tumors or cancer of the LUNG.	A respiratory system cancer that is located_in the lung.
Alias:	Cancer of Lung//Cancer of the Lung//Lung Cancer//Neoplasms, Lung//Neoplasms, Pulmonary//Pulmonary Cancer//Pulmonary Neoplasms	lung neoplasm

Disease Association Statistics

Total Associated tsRNA Number:	102 More Information
Network: (Display the first 15 nodes)