Entry Detail



General Information

Database ID:TRD07434
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002583DOID:4362
Disease Name:Uterine Cervical Neoplasmscervical cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the UTERINE CERVIX.A female reproductive organ cancer that is located_in the cervix.
Alias:Cancer of Cervix//Cancer of the Cervix//Cancer of the Uterine Cervix//Cervical Cancer//Cervical Neoplasms//Cervix Cancer//Cervix Neoplasms//Neoplasms, Cervical//Neoplasms, Cervix//Uterine Cervical Cancercervical neoplasm//cervix cancer//cervix uteri cancer//neoplasm of uterine cervix//tumor of the Cervix Uteri//uterine cervical neoplasm



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)