Entry Detail



General Information

Database ID:TRD07433
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D064726DOID:0060081
Disease Name:Triple Negative Breast Neoplasmstriple-receptor negative breast cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Breast neoplasms that do not express ESTROGEN RECEPTORS; PROGESTERONE RECEPTORS; and do not overexpress the NEU RECEPTOR/HER-2 PROTO-ONCOGENE PROTEIN.A breast cancer that is characterized by the absence of estrogen, progresterone and Her2 receptors.
Alias:ER-Negative PR-Negative HER2-Negative Breast Cancer//ER-Negative PR-Negative HER2-Negative Breast Neoplasms//Triple Negative Breast Cancer//Triple-Negative Breast Cancer//Triple-Negative Breast NeoplasmN/A



Disease Association Statistics

Total Associated tsRNA Number:58
More Information
Network:
(Display the first 15 nodes)