Entry Detail



General Information

Database ID:TRD07431
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077273DOID:3969
Disease Name:Thyroid Cancer, Papillarythyroid gland papillary carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:An ADENOCARCINOMA that originates from follicular cells of the THYROID GLAND and accounts for the majority of THYROID CANCER cases. Cells exhibit enlarged, oval, or elongated morphologies with clear, round, nuclei. Fusions of RET, NTRK1, TPM3, and PCM1 genes are associated with this cancer.A differentiated thyroid gland carcinoma that is characterized by the small mushroom shape of the tumor which has a stem attached to the epithelial layer and arises from the follicular cells of the thyroid gland.
Alias:Familial Nonmedullary Thyroid Cancer//Nonmedullary Thyroid Carcinoma//Papillary Carcinoma Of Thyroid//Papillary Thyroid Carcinoma//Thyroid Carcinoma, PapillaryPapillary carcinoma of the Thyroid gland



Disease Association Statistics

Total Associated tsRNA Number:61
More Information
Network:
(Display the first 15 nodes)