Entry Detail



General Information

Database ID:TRD07428
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D011085DOID:11612
Disease Name:Polycystic Ovary Syndromepolycystic ovary syndrome
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseases//Endocrine System Diseasesdisease of anatomical entity//reproductive system disease
Define:A complex disorder characterized by infertility, HIRSUTISM; OBESITY; and various menstrual disturbances such as OLIGOMENORRHEA; AMENORRHEA; ANOVULATION. Polycystic ovary syndrome is usually associated with bilateral enlarged ovaries studded with atretic follicles, not with cysts. The term, polycystic ovary, is misleading.An ovarian dysfunction that is characterized by hyperandrogenism, polycystic ovaries, hirsutism, oligomenorrhea or amenorrhea, anovulation and excessive body weight.
Alias:Polycystic Ovarian Syndrome//Polycystic Ovary Syndrome 1//Sclerocystic Ovarian Degeneration//Sclerocystic Ovaries//Sclerocystic Ovary Syndrome//Stein-Leventhal SyndromeMulticystic ovaries//PCOS//Polycystic Ovarian disease//Polycystic ovaries//polycystic ovary//Stein-Leventhal synd//Stein-Leventhal syndrome



Disease Association Statistics

Total Associated tsRNA Number:74
More Information
Network:
(Display the first 15 nodes)