Entry Detail


General Information

Database ID:TRD07426
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.01 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010024DOID:11476
Disease Name:Osteoporosisosteoporosis
Category:MeSHDisease Ontology
Type:Musculoskeletal Diseases//Nutritional and Metabolic Diseasesdisease of anatomical entity
Define:Reduction of bone mass without alteration in the composition of bone, leading to fractures. Primary osteoporosis can be of two major types: postmenopausal osteoporosis (OSTEOPOROSIS, POSTMENOPAUSAL) and age-related or senile osteoporosis.A bone resorption disease characterized by decreased density of normally mineralized bone which results_in the thinning of bone tissue and decreased mechanical strength.
Alias:Age-Related Osteoporosis//Bone Loss, Age-Related//Osteoporosis, Age-Related//Osteoporosis, Involutional//Osteoporosis, Post-Traumatic//Osteoporosis, Senile//Senile OsteoporosisN/A



Disease Association Statistics

Total Associated tsRNA Number:73
More Information
Network:
(Display the first 15 nodes)