Entry Detail



General Information

Database ID:TRD07424
Confidence:Prediction
Confidence Score:0.00 (L1-norm-Graph) & 0.00 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008268DOID:10871
Disease Name:Macular Degenerationage related macular degeneration
Category:MeSHDisease Ontology
Type:Eye Diseasesdisease of anatomical entity//genetic disease
Define:Degenerative changes in the RETINA usually of older adults which results in a loss of vision in the center of the visual field (the MACULA LUTEA) because of damage to the retina. It occurs in dry and wet forms.A degeneration of macula and posterior pole that is characterized by a loss of vision in the center of the visual field (the macula) resulting from damage to the retina and resulting in blurring of the sharp central vision.
Alias:Age-Related Macular Degeneration//Age-Related Maculopathies//Age-Related Maculopathy//Macular Degeneration, Age-Related//Macular Dystrophy//Maculopathies, Age-Related//Maculopathy//Maculopathy, Age-RelatedAge Related Maculopathies//Age Related Maculopathy//age-related macular degeneration//Senile macular degeneration//Senile macular retinal degeneration



Disease Association Statistics

Total Associated tsRNA Number:62
More Information
Network:
(Display the first 15 nodes)