Entry Detail



General Information

Database ID:TRD07420
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.02 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003925DOID:11713
Disease Name:Diabetic Angiopathiesdiabetic angiopathy
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Endocrine System Diseasesdisease of anatomical entity
Define:VASCULAR DISEASES that are associated with DIABETES MELLITUS. A peripheral vascular disease that is characterized by narrowing of the arteries as a complication arising from chronic diabetes.
Alias:Diabetic Vascular Complications//Diabetic Vascular Diseases//Microangiopathy, Diabeticdiabetic peripheral angiopathy//Diabetic vascular disorder



Disease Association Statistics

Total Associated tsRNA Number:28
More Information
Network:
(Display the first 15 nodes)