Entry Detail


General Information

Database ID:TRD07418
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.03 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D021441DOID:3498
Disease Name:Carcinoma, Pancreatic Ductalpancreatic ductal adenocarcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Carcinoma that arises from the PANCREATIC DUCTS. It accounts for the majority of cancers derived from the PANCREAS.A pancreatic adenocarcinoma that derives_from pancreatic duct cells.
Alias:Carcinoma, Ductal, Pancreatic//Duct-Cell Carcinoma of the Pancreas//Duct-Cell Carcinoma, Pancreas//Ductal Carcinoma of the Pancreas//Pancreatic Duct Cell Carcinoma//Pancreatic Ductal Carcinomaductal adenocarcinoma of the pancreas



Disease Association Statistics

Total Associated tsRNA Number:114
More Information
Network:
(Display the first 15 nodes)