Entry Detail



General Information

Database ID:TRD07416
Confidence:Prediction
Confidence Score:0.03 (L1-norm-Graph) & 0.05 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077192DOID:3910
Disease Name:Adenocarcinoma of Lunglung adenocarcinoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of anatomical entity//disease of cellular proliferation
Define:A carcinoma originating in the lung and the most common lung cancer type in never-smokers. Malignant cells exhibit distinct features such as glandular epithelial, or tubular morphology. Mutations in KRAS, EGFR, BRAF, and ERBB2 genes are associated with this cancer.A lung non-small cell carcinoma that derives_from epithelial cells of glandular origin.
Alias:Lung Adenocarcinomaadenocarcinoma of lung//bronchogenic lung adenocarcinoma//nonsmall cell adenocarcinoma



Disease Association Statistics

Total Associated tsRNA Number:203
More Information
Network:
(Display the first 15 nodes)