Entry Detail



General Information

Database ID:TRD07163
Confidence:Prediction
Confidence Score:0.02 (L1-norm-Graph) & 0.17 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:tRF-22-8BWS7K092
tsRNA Type:tRF-3
Amino acid and Anticodon:GlnTTG
Sequence:TCAAATCTCGGTGGGACTCCA
Related Target:Hippo
Predicted Target:HIVEP3//TOR3A//KRBA1//NOVA1//ZNF510//SLC4A8//ELN//ZMYM4//WDR33//TBCC
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D055370N/A
Disease Name:Lung InjuryN/A
Category:MeSHDisease Ontology
Type:Respiratory Tract Diseases//Wounds and InjuriesN/A
Define:Damage to any compartment of the lung caused by physical, chemical, or biological agents which characteristically elicit inflammatory reaction. These inflammatory reactions can either be acute and dominated by NEUTROPHILS, or chronic and dominated by LYMPHOCYTES and MACROPHAGES.N/A
Alias:Chronic Lung Injury//E-Cigarette Use-Associated Lung Injury//E-Cigarette or Vaping Product Use-Associated Lung Injury//EVALI//Lung Injuries//Pulmonary Injury//Vaping Product Use-Associated Lung InjuryN/A



Disease Association Statistics

Total Associated tsRNA Number:81
More Information
Network:
(Display the first 15 nodes)