tsRNADisease

Entry Detail

General Information

Database ID:	TRD07010
Confidence:	Prediction
Confidence Score:	0.00 (L1-norm-Graph) & 0.00 (WBNPMD)
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics

tsRNA Information

tsRNA Name:

tRF-22-8EKSP1852

tsRNA Type:

tRF-3

Amino acid and Anticodon:

AlaAGC

Sequence:

TCAATCCCCGGCACCTCCACCA

Related Target:

N/A

Predicted Target:

NEO1//RBM27//FAM171A2//DCHS1//RAB43//ISY1-RAB43//IFI44L//SMTN//MEX3A//RETREG3

External Links:

MINTbase ID:	tRF-22-8EKSP1852
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	7 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D028361	N/A
Disease Name:	Mitochondrial Diseases	N/A
Category:	MeSH	Disease Ontology
Type:	Nutritional and Metabolic Diseases	N/A
Define:	Diseases caused by abnormal function of the MITOCHONDRIA. They may be caused by mutations, acquired or inherited, in mitochondrial DNA or in nuclear genes that code for mitochondrial components. They may also be the result of acquired mitochondria dysfunction due to adverse effects of drugs, infections, or other environmental causes.	N/A
Alias:	Electron Transport Chain Deficiencies, Mitochondrial//Mitochondrial Disorders//Mitochondrial Electron Transport Chain Deficiencies//Mitochondrial Respiratory Chain Deficiencies//Oxidative Phosphorylation Deficiencies//Respiratory Chain Deficiencies, Mitochondrial	N/A

Disease Association Statistics

Total Associated tsRNA Number:	69 More Information
Network: (Display the first 15 nodes)