Entry Detail



General Information

Database ID:TRD06923
Confidence:Prediction
Confidence Score:0.01 (L1-norm-Graph) & 0.08 (WBNPMD)
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics



tsRNA Information

tsRNA Name:AS-tDR-012929
tsRNA Type:tRF-1
Amino acid and Anticodon:N/A
Sequence:GAGTCTACCTAGACTTTTGAGCACAGGATTT
Related Target:N/A
Predicted Target:LARS2//IGSF9B//PLA2R1//GIMAP6//TG//UNC13B//SLC24A3//AP2A2//DCP2//SGTA
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D005923DOID:1312
Disease Name:Glomerulosclerosis, Focal Segmentalfocal segmental glomerulosclerosis
Category:MeSHDisease Ontology
Type:Urogenital Diseasesdisease of anatomical entity
Define:A clinicopathological syndrome or diagnostic term for a type of glomerular injury that has multiple causes, primary or secondary. Clinical features include PROTEINURIA, reduced GLOMERULAR FILTRATION RATE, and EDEMA. Kidney biopsy initially indicates focal segmental glomerular consolidation (hyalinosis) or scarring which can progress to globally sclerotic glomeruli leading to eventual KIDNEY FAILURE.A disease that manifests in a defined anatomical structure.
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:89
More Information
Network:
(Display the first 15 nodes)